90
|
TIB MOLBIOL
plasmid clone of the m. tuberculosis complex target sequence (katg gene) Plasmid Clone Of The M. Tuberculosis Complex Target Sequence (Katg Gene), supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid clone of the m. tuberculosis complex target sequence (katg gene)/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
plasmid clone of the m. tuberculosis complex target sequence (katg gene) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
EUROIMMUN
293 cells transfected with plasmids containing human target gene sequences 293 Cells Transfected With Plasmids Containing Human Target Gene Sequences, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/293 cells transfected with plasmids containing human target gene sequences/product/EUROIMMUN Average 90 stars, based on 1 article reviews
293 cells transfected with plasmids containing human target gene sequences - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
plasmid containing sgrna targeting the mouse chd1 gene and a puromycin selection marker Plasmid Containing Sgrna Targeting The Mouse Chd1 Gene And A Puromycin Selection Marker, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid containing sgrna targeting the mouse chd1 gene and a puromycin selection marker/product/GenScript corporation Average 90 stars, based on 1 article reviews
plasmid containing sgrna targeting the mouse chd1 gene and a puromycin selection marker - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Biomatik
ppiczαa plasmid containing the egki-1 gene sequence Ppiczαa Plasmid Containing The Egki 1 Gene Sequence, supplied by Biomatik, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ppiczαa plasmid containing the egki-1 gene sequence/product/Biomatik Average 90 stars, based on 1 article reviews
ppiczαa plasmid containing the egki-1 gene sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
RayBiotech inc
plasmid containing cloned target sequences hadv hexon gene Plasmid Containing Cloned Target Sequences Hadv Hexon Gene, supplied by RayBiotech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid containing cloned target sequences hadv hexon gene/product/RayBiotech inc Average 90 stars, based on 1 article reviews
plasmid containing cloned target sequences hadv hexon gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
plasmids containing dna oligonucleotides with the target sequence of p. ovale wallikeri ssrrna gene Plasmids Containing Dna Oligonucleotides With The Target Sequence Of P. Ovale Wallikeri Ssrrna Gene, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmids containing dna oligonucleotides with the target sequence of p. ovale wallikeri ssrrna gene/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
plasmids containing dna oligonucleotides with the target sequence of p. ovale wallikeri ssrrna gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene Plasmid Containing The Mouse Opn5 Grna Sequence (Gctcaggtgcatagtccccc) And A Puromycin Resistance Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene/product/GenScript corporation Average 90 stars, based on 1 article reviews
plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
luciferase-linked promoter reporter plasmids containing 1,547 of 5' flanking sequence from the human lox gene Luciferase Linked Promoter Reporter Plasmids Containing 1,547 Of 5' Flanking Sequence From The Human Lox Gene, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luciferase-linked promoter reporter plasmids containing 1,547 of 5' flanking sequence from the human lox gene/product/Promega Average 90 stars, based on 1 article reviews
luciferase-linked promoter reporter plasmids containing 1,547 of 5' flanking sequence from the human lox gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
plasmid containing the arnd sequence gene Plasmid Containing The Arnd Sequence Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid containing the arnd sequence gene/product/GenScript corporation Average 90 stars, based on 1 article reviews
plasmid containing the arnd sequence gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Valentis Inc
plasmid of gmp grade containing the pcmv-luc reporter gene without immunostimulatory cpg sequences Plasmid Of Gmp Grade Containing The Pcmv Luc Reporter Gene Without Immunostimulatory Cpg Sequences, supplied by Valentis Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid of gmp grade containing the pcmv-luc reporter gene without immunostimulatory cpg sequences/product/Valentis Inc Average 90 stars, based on 1 article reviews
plasmid of gmp grade containing the pcmv-luc reporter gene without immunostimulatory cpg sequences - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
POSTECH Inc
standard plasmids containing the full-length 16s rrna gene sequences Standard Plasmids Containing The Full Length 16s Rrna Gene Sequences, supplied by POSTECH Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/standard plasmids containing the full-length 16s rrna gene sequences/product/POSTECH Inc Average 90 stars, based on 1 article reviews
standard plasmids containing the full-length 16s rrna gene sequences - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ipsogen Inc
plasmids containing the target gene Plasmids Containing The Target Gene, supplied by Ipsogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmids containing the target gene/product/Ipsogen Inc Average 90 stars, based on 1 article reviews
plasmids containing the target gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |