plasmids containing the respective target gene sequences Search Results


90
TIB MOLBIOL plasmid clone of the m. tuberculosis complex target sequence (katg gene)
Plasmid Clone Of The M. Tuberculosis Complex Target Sequence (Katg Gene), supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid clone of the m. tuberculosis complex target sequence (katg gene)/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
plasmid clone of the m. tuberculosis complex target sequence (katg gene) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
EUROIMMUN 293 cells transfected with plasmids containing human target gene sequences
293 Cells Transfected With Plasmids Containing Human Target Gene Sequences, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/293 cells transfected with plasmids containing human target gene sequences/product/EUROIMMUN
Average 90 stars, based on 1 article reviews
293 cells transfected with plasmids containing human target gene sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation plasmid containing sgrna targeting the mouse chd1 gene and a puromycin selection marker
Plasmid Containing Sgrna Targeting The Mouse Chd1 Gene And A Puromycin Selection Marker, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid containing sgrna targeting the mouse chd1 gene and a puromycin selection marker/product/GenScript corporation
Average 90 stars, based on 1 article reviews
plasmid containing sgrna targeting the mouse chd1 gene and a puromycin selection marker - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biomatik ppiczαa plasmid containing the egki-1 gene sequence
Ppiczαa Plasmid Containing The Egki 1 Gene Sequence, supplied by Biomatik, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ppiczαa plasmid containing the egki-1 gene sequence/product/Biomatik
Average 90 stars, based on 1 article reviews
ppiczαa plasmid containing the egki-1 gene sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
RayBiotech inc plasmid containing cloned target sequences hadv hexon gene
Plasmid Containing Cloned Target Sequences Hadv Hexon Gene, supplied by RayBiotech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid containing cloned target sequences hadv hexon gene/product/RayBiotech inc
Average 90 stars, based on 1 article reviews
plasmid containing cloned target sequences hadv hexon gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TIB MOLBIOL plasmids containing dna oligonucleotides with the target sequence of p. ovale wallikeri ssrrna gene
Plasmids Containing Dna Oligonucleotides With The Target Sequence Of P. Ovale Wallikeri Ssrrna Gene, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmids containing dna oligonucleotides with the target sequence of p. ovale wallikeri ssrrna gene/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
plasmids containing dna oligonucleotides with the target sequence of p. ovale wallikeri ssrrna gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene
Plasmid Containing The Mouse Opn5 Grna Sequence (Gctcaggtgcatagtccccc) And A Puromycin Resistance Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene/product/GenScript corporation
Average 90 stars, based on 1 article reviews
plasmid containing the mouse opn5 grna sequence (gctcaggtgcatagtccccc) and a puromycin resistance gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega luciferase-linked promoter reporter plasmids containing 1,547 of 5' flanking sequence from the human lox gene
Luciferase Linked Promoter Reporter Plasmids Containing 1,547 Of 5' Flanking Sequence From The Human Lox Gene, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/luciferase-linked promoter reporter plasmids containing 1,547 of 5' flanking sequence from the human lox gene/product/Promega
Average 90 stars, based on 1 article reviews
luciferase-linked promoter reporter plasmids containing 1,547 of 5' flanking sequence from the human lox gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation plasmid containing the arnd sequence gene
Plasmid Containing The Arnd Sequence Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid containing the arnd sequence gene/product/GenScript corporation
Average 90 stars, based on 1 article reviews
plasmid containing the arnd sequence gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Valentis Inc plasmid of gmp grade containing the pcmv-luc reporter gene without immunostimulatory cpg sequences
Plasmid Of Gmp Grade Containing The Pcmv Luc Reporter Gene Without Immunostimulatory Cpg Sequences, supplied by Valentis Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid of gmp grade containing the pcmv-luc reporter gene without immunostimulatory cpg sequences/product/Valentis Inc
Average 90 stars, based on 1 article reviews
plasmid of gmp grade containing the pcmv-luc reporter gene without immunostimulatory cpg sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
POSTECH Inc standard plasmids containing the full-length 16s rrna gene sequences
Standard Plasmids Containing The Full Length 16s Rrna Gene Sequences, supplied by POSTECH Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/standard plasmids containing the full-length 16s rrna gene sequences/product/POSTECH Inc
Average 90 stars, based on 1 article reviews
standard plasmids containing the full-length 16s rrna gene sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ipsogen Inc plasmids containing the target gene
Plasmids Containing The Target Gene, supplied by Ipsogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmids containing the target gene/product/Ipsogen Inc
Average 90 stars, based on 1 article reviews
plasmids containing the target gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results